View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17235_high_12 (Length: 201)
Name: NF17235_high_12
Description: NF17235
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17235_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 16 - 185
Target Start/End: Original strand, 45389730 - 45389899
Alignment:
| Q |
16 |
atgaatgaatgtattgggtccctcattgaatgataaatgacgtgaaaatgtgtttaagtgagaggcttccctcaccttattagtcggttttgcaggtgta |
115 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45389730 |
atgaatgaatgtattgagtccctcattgaatgataaatggcgtgaaaatgtgtttaagtgagaggcttccctcaccttattagtcggttttgcaggtgta |
45389829 |
T |
 |
| Q |
116 |
accaaaattttgagatacctcattccctcgataccacacttgcatttaagtgttctattctgatgcaact |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45389830 |
accaaaattttgagatacctcattccctcgataccacacttgcatttaagtcttctattctgatgcaact |
45389899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University