View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17237_low_3 (Length: 208)
Name: NF17237_low_3
Description: NF17237
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17237_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 13 - 191
Target Start/End: Original strand, 35782484 - 35782662
Alignment:
| Q |
13 |
gaagaatatggttgtattttgtgggatctagctgccagtaaaacacatgcggaactcatggtactactctatttttgttgggttttaatttttatacatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35782484 |
gaagaatatggttgtattttgtgggatctagctgccagtaaaacacatgcggaactcatggtactactctatttttgttgggttttaatttttatacatt |
35782583 |
T |
 |
| Q |
113 |
gacacttgacaatgtaaaacatttttacacacgcatccaatcaaactgcgctatgtagatacttgtcataagaaaattg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35782584 |
gacacttgacaatgtaaaacatttttacacacgcatccaatcaaactgcgctatgtagatacttgtcataagaaaattg |
35782662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 125 - 157
Target Start/End: Complemental strand, 19711257 - 19711225
Alignment:
| Q |
125 |
tgtaaaacatttttacacacgcatccaatcaaa |
157 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
19711257 |
tgtaaaacatttttagacacgcatccaatcaaa |
19711225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University