View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17238_high_5 (Length: 243)
Name: NF17238_high_5
Description: NF17238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17238_high_5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 6 - 243
Target Start/End: Original strand, 16012428 - 16012666
Alignment:
| Q |
6 |
tggacatcatcattctagggattatgtagccattgaatttatatagtagtttacatatctgcaatatgaatttcaaaatgatta-taacttgatatgata |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16012428 |
tggacatcatcattctagggattatgtagccattgaatttatatagtagtttacatatctgcaatatgaatttcaaaatgattaataacttgatatgata |
16012527 |
T |
 |
| Q |
105 |
tactaaatattatgtttcttaggtgctccacttacttaattttatgtttttgtgtgaaggcattcattacattaaaaagaggaacccagttagttaagta |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16012528 |
tactaaatattatgttgcttaggtgctccacttacttaattttatgtttttgtgtgaaggcattcattacattaaaaagaggaacccagttagttaagta |
16012627 |
T |
 |
| Q |
205 |
tagtcgacaagggaagccaaaactttgtaatttcaggct |
243 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16012628 |
tagtcgacaagggaagccgaaactttgtaatttcaggct |
16012666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University