View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17238_low_5 (Length: 249)
Name: NF17238_low_5
Description: NF17238
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17238_low_5 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 8 - 249
Target Start/End: Complemental strand, 16013067 - 16012827
Alignment:
| Q |
8 |
gatcagagagttcgagcaagtgtgccctacgtctccgacaatagagtggctactgtagtttctactatgaaactcttacagttgcagattacaagttatg |
107 |
Q |
| |
|
||||| |||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
16013067 |
gatcacagagttcgagcaagtgtgcc-tacgactccgacaatagagtggctactgtagtttctactatgaaattcttgcagttgcagattacaagttatg |
16012969 |
T |
|
| Q |
108 |
tttaaatactacggtcaagtttacccttaaattccaatgcgaggggcttcgcccactataccccaaccctcctaatcgtaacccaacatatgtatgggcc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16012968 |
tttaaatactacggtcaagtttacccttaaattgcaatgcgagggacttcgcccactataccccaaccctcctaatcttaacccaacatatgtatgggcc |
16012869 |
T |
|
| Q |
208 |
aaacttaagcggaaggcaatctagctgcactacgctcgttgc |
249 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16012868 |
aaacttaagcggaaggcactctagctgcactacgctcgttgc |
16012827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 92 - 131
Target Start/End: Original strand, 13855051 - 13855090
Alignment:
| Q |
92 |
cagattacaagttatgtttaaatactacggtcaagtttac |
131 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
13855051 |
cagattacaacttatgtttaaatactacggtctagtttac |
13855090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University