View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17239_high_32 (Length: 240)
Name: NF17239_high_32
Description: NF17239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17239_high_32 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 2518565 - 2518342
Alignment:
| Q |
17 |
ctctcaaggcatctgtaatttcttgtaacggaattttagatacatgactaatctcaaccttaaatgttttggaccgagattgacgcttcattctcttggt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2518565 |
ctctcaaggcatctgtaatttcttgtaacggaattttagatacatgactaatctcaaccttaaatgttttggaccgagattgatgcttcattctcttggt |
2518466 |
T |
 |
| Q |
117 |
tgcttcagaagggttgcttccaactcttaaaaacaagcatgtgatattagtcggtgtttttggctaacaaagaaatgtatcaacacaatcgcatattttc |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2518465 |
tgcttcagaagggttgcttccaactcttaaaaacaagcatgtgatatgagtcggtgtttttggctaacaaagaaatgtatcaacacaatcgcatattttc |
2518366 |
T |
 |
| Q |
217 |
tatgaaatcattagtatttacctc |
240 |
Q |
| |
|
|||||||||||||| ||||||||| |
|
|
| T |
2518365 |
tatgaaatcattagcatttacctc |
2518342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University