View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17239_low_23 (Length: 323)
Name: NF17239_low_23
Description: NF17239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17239_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 2 - 312
Target Start/End: Original strand, 45001596 - 45001907
Alignment:
| Q |
2 |
tcagtatttatacattcccccgcattcgcatgctgtaactttgccgcaatggattctcctccctcctccgttgtcgtccttctcattgcgctcg-gctgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||| |
|
|
| T |
45001596 |
tcagtatttatacattcccccgcattcgtatgctgtaactttgccgcaatggattctcctccctcctccattgtcgtccttctcattgcgctcgcgatgg |
45001695 |
T |
 |
| Q |
101 |
ccacctgttgcttcgccactcaccgtttcaaagcacccgcacgggtcgttcttcctgatgaaatggtgctttcagggccaccgtcgccatattcatctga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | || |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45001696 |
ccacctgttgcttcgccactcaccgtttcaaagcacccgcgcatgttgttcttcctgatgaaatggtgctttctgggccaccgtcgccatattcatctga |
45001795 |
T |
 |
| Q |
201 |
cagtgaggcagcagacttgtttgttttgtattcattaaacggttgcttcttcttctaccaaccatttcatcatcgtttgttgttgcaatatgtggaactg |
300 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45001796 |
cagtgaggcagcatacttgtttgttttgtattcattaaacggttgcttcttcttctaccaaccatttcatcatcgtttgctgttgcaatatgtggaactg |
45001895 |
T |
 |
| Q |
301 |
gaatctctctct |
312 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45001896 |
gaatctctctct |
45001907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University