View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17239_low_30 (Length: 285)
Name: NF17239_low_30
Description: NF17239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17239_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 43 - 277
Target Start/End: Original strand, 942259 - 942496
Alignment:
| Q |
43 |
tactattattgtactctggttctctaagatacattctttagtacaccttgtgttgtagtggtctgttttggtttgttaataatatatttgtgctcttttt |
142 |
Q |
| |
|
||||||||||||||| ||||||||| | | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
942259 |
tactattattgtactttggttctctgacagacattctttagtacaccttgtgttgctgtggtctgttttggtttgttaataatatatttgtgctcttttt |
942358 |
T |
 |
| Q |
143 |
tcactcnnnnnnnnta---atatttgtgatctttttggcctttnnnnnnngaatgtttaattgctttgatgatttattttttgaggggtgctttgatgaa |
239 |
Q |
| |
|
|||||| || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
942359 |
tcactcaaaaaaaatatatatatttgtgatctttttggcctttaaaaaaagaatgtttaattgctttgatgatttattttttgaggggtgctttaatgaa |
942458 |
T |
 |
| Q |
240 |
ttaattatataggtggtttatgccgttaaatattcttc |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
942459 |
ttaattatataggtggtttatgccgttaaatattcttc |
942496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 76 - 123
Target Start/End: Original strand, 38037717 - 38037764
Alignment:
| Q |
76 |
ttctttagtacaccttgtgttgtagtggtctgttttggtttgttaata |
123 |
Q |
| |
|
|||||| ||| ||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
38037717 |
ttctttcgtataccttgtgttgaagtggtatgttttggtttgttaata |
38037764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University