View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17239_low_35 (Length: 252)
Name: NF17239_low_35
Description: NF17239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17239_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 5 - 236
Target Start/End: Complemental strand, 47494574 - 47494343
Alignment:
| Q |
5 |
gagaagcaaaggattttcactttgaaacagcttatttgtcagtgacttacttggatcgattcctttctaaacacttcattgatgtaagctctaattatga |
104 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47494574 |
gagaagcattggattttcactttgaaacagcttatttgtcagtgacttacttggatcgattcctttctaaacacttcattgatgtaagctctaattatga |
47494475 |
T |
 |
| Q |
105 |
tcttccaaatgcagcatttgtttctatcaattggtcactcctgtttaagttttcatcaatctaattaattgattaattatttaattacccttttggttga |
204 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47494474 |
tattccaaatgcagcatttgtttctatcaattggtcactcctgtttaagttttcatcaatctaattaattgattaattatttaattacccttttggttga |
47494375 |
T |
 |
| Q |
205 |
atttttacattttaagcagggtgagaaggatt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47494374 |
atttttacattttaagcagggtgagaaggatt |
47494343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University