View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17239_low_38 (Length: 238)
Name: NF17239_low_38
Description: NF17239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17239_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 9765009 - 9764944
Alignment:
| Q |
24 |
gttcagccctccatattgcttctctttaaataataacagctaatgataatccacttgactcaatac |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9765009 |
gttcagccctccatattgcttctctttaaataataacaactaatgataatccacttgactcaatac |
9764944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 169 - 220
Target Start/End: Complemental strand, 9764871 - 9764820
Alignment:
| Q |
169 |
gtatgactcactgtcatcactaagacagcttctgaagcttagatggcctttg |
220 |
Q |
| |
|
||||| ||||| ||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9764871 |
gtatgtctcaccgtcgtcactaagacaacttctgaagcttagatggcctttg |
9764820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University