View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17239_low_39 (Length: 229)
Name: NF17239_low_39
Description: NF17239
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17239_low_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 22 - 215
Target Start/End: Original strand, 2470101 - 2470310
Alignment:
| Q |
22 |
attcatatttatttgtattgtcacttgtttcaatttagctata----------------gcatatcaagataaaataaaacccaaaaaacgtagcaaatt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
2470101 |
attcatatttatttgtattgtcacttgtttcaatttagctatataagaagctatatatagcatataaagataaaataaaacccaaaaatcgtagcaaatt |
2470200 |
T |
|
| Q |
106 |
aatgagtttgaaatttgtggtgtttaactgtattaagtgatttccctttctaatttcctatctctttctctctcactctatctccctgaagagatcttgg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2470201 |
aatgagtttgaaatttgtggtgtttaactgtattaagtgatttccctttcgtatttcctatctctttctctctcactctatctccctgaagagatcttgg |
2470300 |
T |
|
| Q |
206 |
atagaataat |
215 |
Q |
| |
|
|||||||||| |
|
|
| T |
2470301 |
atagaataat |
2470310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University