View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1723_high_13 (Length: 349)
Name: NF1723_high_13
Description: NF1723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1723_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 315; Significance: 1e-177; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 18 - 336
Target Start/End: Complemental strand, 37318531 - 37318213
Alignment:
| Q |
18 |
tgttgacacagagaatggcaagctaagttctcaggaaaagaagacaattgatgcaatagtgaaagccaggtatgttttgtagttgcttctctcctctgat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37318531 |
tgttgacacagagaatggcaagctaagttctcaggaaaagaagacaattgatgcaatagtgaaagccaggtatgttttgtagttgcttctctcctctgat |
37318432 |
T |
 |
| Q |
118 |
acgctatcctggattcttacactcactaaattgcagtgagtatccgctgtcgatagttttggttggagttggagatggaccgtgggatatgatgagggaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37318431 |
acgctatcctggattcttacactcactaaattgcagtgagtatccgctgtcgatagttttggttggagttggagatggaccgtgggatatgatgagggaa |
37318332 |
T |
 |
| Q |
218 |
tttgacgataacattccagctcgagccttcgacaattttcaggtttggtgtaatgtacatgaccatatattggctttccatattcaaatcttactactat |
317 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37318331 |
tttgacgataatattccagctcgagccttcgacaattttcaggtttggtgtaatgtacatgaccatatattggctttccatattcaaatcttactactat |
37318232 |
T |
 |
| Q |
318 |
gcagaaatatgaatatttt |
336 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
37318231 |
gcagaaatatgaatatttt |
37318213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 285 - 336
Target Start/End: Original strand, 1361583 - 1361635
Alignment:
| Q |
285 |
tattggctttccatattcaa-atcttactactatgcagaaatatgaatatttt |
336 |
Q |
| |
|
||||||| | |||||||||| ||||||||| ||||||||||| |||||||||| |
|
|
| T |
1361583 |
tattggcatgccatattcaatatcttactattatgcagaaatgtgaatatttt |
1361635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 143 - 265
Target Start/End: Complemental strand, 39202106 - 39201984
Alignment:
| Q |
143 |
ctaaattgcagtgagtatccgctgtcgatagttttggttggagttggagatggaccgtgggatatgatgagggaatttgacgataacattccagctcgag |
242 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||||||||| |||||||| ||||||| ||||||||| || ||||| || |||| | |
|
|
| T |
39202106 |
ctaaattgcagtgagtatccattgtcaatagttttggtaggagttggagatgggccgtgggagatgatgaaggaatttgatgacaacatcccttctcggg |
39202007 |
T |
 |
| Q |
243 |
ccttcgacaattttcaggtttgg |
265 |
Q |
| |
|
| || |||||||||||||||||| |
|
|
| T |
39202006 |
cgtttgacaattttcaggtttgg |
39201984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 182 - 261
Target Start/End: Complemental strand, 34392555 - 34392476
Alignment:
| Q |
182 |
ggagttggagatggaccgtgggatatgatgagggaatttgacgataacattccagctcgagccttcgacaattttcaggt |
261 |
Q |
| |
|
|||||||||||||| || ||||| ||||||| | ||||||||||||||||| || ||||| || || ||||||||||| |
|
|
| T |
34392555 |
ggagttggagatgggccatgggacatgatgaaacagtttgacgataacattcctgcacgagcatttgataattttcaggt |
34392476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 176 - 264
Target Start/End: Complemental strand, 11689121 - 11689033
Alignment:
| Q |
176 |
ttggttggagttggagatggaccgtgggatatgatgagggaatttgacgataacattccagctcgagccttcgacaattttcaggtttg |
264 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||||| |||||||||||||| |||||| |||| |||||||| ||||| |||||||| |
|
|
| T |
11689121 |
ttggttggtgttggagatggaccatgggacatgatgaaagaatttgacgataatattccatctcgtgccttcgataatttccaggtttg |
11689033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 176 - 261
Target Start/End: Original strand, 7474148 - 7474233
Alignment:
| Q |
176 |
ttggttggagttggagatggaccgtgggatatgatgagggaatttgacgataacattccagctcgagccttcgacaattttcaggt |
261 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||||||| ||| ||||| || || || ||||| | |||||||| ||||||||||| |
|
|
| T |
7474148 |
ttggttggtgttggagatggaccttgggacatgatgaaggagtttgatgacaatatgccagccagggccttcgataattttcaggt |
7474233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University