View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1723_high_30 (Length: 244)
Name: NF1723_high_30
Description: NF1723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1723_high_30 |
| |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 15 - 234
Target Start/End: Complemental strand, 50308353 - 50308134
Alignment:
Q |
15 |
agtttcatgttctcacttcctaacacaaaaccaaatggaaattttgtatttcatttagtctggtgatcaataacagtttgaaatgcaccagccaatgctc |
114 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
50308353 |
agtttcatgttctcacttcctaacacaaaaccaaaaggaaattttgtatttcatttagtctggtgatcgataacagtttgaaatgcaccagccaatgctc |
50308254 |
T |
|
Q |
115 |
tcactttattctttctctcttctcgtaacttgctagcagtttcttcaatcacatcattagatacttgagaagactctttcttcccttgcaccacgccact |
214 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
50308253 |
tcactttattctttctctcttctcgtaacttgctagcagtttcttcaatcacatcattagatacttgagaagattctttcttcccttgcaccacgccact |
50308154 |
T |
|
Q |
215 |
ttcttcttccttttcctttg |
234 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
50308153 |
ttcttcttccttttcctttg |
50308134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2045 times since January 2019
Visitors: 1267