View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17241_high_40 (Length: 288)
Name: NF17241_high_40
Description: NF17241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17241_high_40 |
 | |
|
| [»] scaffold0004 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0004 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 18 - 139
Target Start/End: Complemental strand, 82121 - 82000
Alignment:
| Q |
18 |
aatactagttatgtctcgatggaaattgagtctataggaaaagattatactcccaatgtgtgactaaccaatgtatgattttttggctgagagatgtatc |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
82121 |
aatactagttatgtctcgatggagattgagtctataggaaaagattatactcccaatgtgtgactaaccaatgtatgattttttggctgagagatgtatc |
82022 |
T |
|
| Q |
118 |
caagtttattgtttgacgtgtt |
139 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
82021 |
caagtttattgtttgacgtgtt |
82000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 185 - 279
Target Start/End: Complemental strand, 81953 - 81859
Alignment:
| Q |
185 |
actaattatggttatggaactacaatattacttattgctttaattgatttttatgagcaggtgttgacaatgttacttatctcaagcatctctgc |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
81953 |
actaattatggttatggaactacaatattacttattgctttaattgatttttctgagcaggtgttgacaatgttacttatctcaagcatctctgc |
81859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University