View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17241_high_44 (Length: 266)
Name: NF17241_high_44
Description: NF17241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17241_high_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 12 - 195
Target Start/End: Original strand, 50243190 - 50243373
Alignment:
| Q |
12 |
agcataggtaggaatctattctattcaactaccaatataaaatgactatgtcggtgttgtgccaatgtcacatacacctacacatgttagacattgaaca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50243190 |
agcataggtaggaatctattctattcaactaccaatataaaatgactatgtcggtgttgtgccaatgtcacatacacctacacatgttagacattgaaca |
50243289 |
T |
 |
| Q |
112 |
tgctttcaatctcaagtgtcggggcgatatagttgttacttattattattgttgtgacagacaacgaaatactatgtgaatttc |
195 |
Q |
| |
|
|| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50243290 |
tgttttcaatctcaagtgtcgggccgatatagttgttacttattattattgttgtgacagacaacgaaatactatgtgaatttc |
50243373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 95 - 131
Target Start/End: Complemental strand, 3963755 - 3963719
Alignment:
| Q |
95 |
atgttagacattgaacatgctttcaatctcaagtgtc |
131 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
3963755 |
atgttagacattgaacatgccttcaatctaaagtgtc |
3963719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University