View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17241_high_49 (Length: 238)
Name: NF17241_high_49
Description: NF17241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17241_high_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 235
Target Start/End: Complemental strand, 42991312 - 42991096
Alignment:
| Q |
18 |
cttatagggtatacaccaaatattttccataacaatattgtaaaaaggaggcgacaattcaaagatgtgtacacgctgagctgaacactcgtaaacaaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42991312 |
cttatagggtatacaccaaatattttccataacaatattgtaaaaaggaggcgacaattcaaagat-tgtacacgctgagctgaacactcgtaaacaaga |
42991214 |
T |
 |
| Q |
118 |
cgtttgcgcgtttcgaaaacgaaccactactccaaatgcttcttgccgtaattattttctcaactagttggtataatttaaggtcaaatacgtagtttga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42991213 |
cgtttgcgcgtttcgaaaacgaaccactactccaaatgcttcttgccgtaattattttctcaactagttggtataatttaaggtcaaatacttagtttga |
42991114 |
T |
 |
| Q |
218 |
aaaaattctcaacttaat |
235 |
Q |
| |
|
||||| | |||| ||||| |
|
|
| T |
42991113 |
aaaaaatttcaagttaat |
42991096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University