View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17241_high_55 (Length: 231)

Name: NF17241_high_55
Description: NF17241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17241_high_55
NF17241_high_55
[»] chr2 (1 HSPs)
chr2 (26-200)||(546101-546273)


Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 26 - 200
Target Start/End: Original strand, 546101 - 546273
Alignment:
26 gctgaagacgagaacgacaggagggtttctagtcgaaatagttgcttgcagggaagaagccttctgttggtaactcagattgtttttgacggatactcaa 125  Q
    |||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
546101 gctgaagacgagaacgaccggagggtttctagtagaaatagttgcttgcagggaagaaaccttctgttggtaactcagattgtttttgacggatactcaa 546200  T
126 caggctgtttcctttggcttttggcatatactcctttcttttaccgtgattggtgctcagttatgttataactta 200  Q
    ||||||| ||||||||||  |||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
546201 caggctgcttcctttggc--ttggcataaactcctttcttttaccgtgattggtgctcagttatgttataactta 546273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University