View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17241_high_56 (Length: 205)

Name: NF17241_high_56
Description: NF17241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17241_high_56
NF17241_high_56
[»] chr7 (2 HSPs)
chr7 (20-123)||(48139767-48139870)
chr7 (160-192)||(48139911-48139943)


Alignment Details
Target: chr7 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 20 - 123
Target Start/End: Original strand, 48139767 - 48139870
Alignment:
20 caattgatgatcgaccctgttattttgtccaccggacaggtacttctttttcttattggttatggttattgctctgtattttattatcttctccacaagt 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48139767 caattgatgatcgaccctgttattttgtccaccggacaggtacttctttttcttattggttatggttattgctctgtattttattatcttctccacaagt 48139866  T
120 tgtc 123  Q
    ||||    
48139867 tgtc 48139870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 192
Target Start/End: Original strand, 48139911 - 48139943
Alignment:
160 ataactcaaacataggtttttctaatccctttg 192  Q
    |||||||||||||||||||||||||||| ||||    
48139911 ataactcaaacataggtttttctaatccttttg 48139943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University