View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17241_low_11 (Length: 477)
Name: NF17241_low_11
Description: NF17241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17241_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 4e-73; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 4e-73
Query Start/End: Original strand, 279 - 441
Target Start/End: Original strand, 1541327 - 1541490
Alignment:
| Q |
279 |
agtacatgtacacctttttacgatagctaggtggaacctatatttgtaacttctatattctactgaataatttttacag-ccatgaaacaaacaccgcct |
377 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1541327 |
agtacatgtacacctttttacgatagctaggtggaacctatatttgtaacttctatattctagtgaataatttttacaaaccatgaaacaaacaccgcct |
1541426 |
T |
|
| Q |
378 |
tacggtatcgtattcctacccagcatgttatctcatctcaatcatcaacggaagaacatagctc |
441 |
Q |
| |
|
||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1541427 |
tactgtatcgtattgctacccagcatgttatctcatctcaatcatcaacggaagaacatagctc |
1541490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 72 - 185
Target Start/End: Original strand, 1541133 - 1541242
Alignment:
| Q |
72 |
ggaggagtagaaacgcatcttacgttagtattcaccaaataggaaactctagagagagagtgtacgcatcttacttactattccaaatttcacacactac |
171 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1541133 |
ggaggagtagaaacgcatcttatgttagtattcaccaaataggaaactctagag----agtgtacgcatcttacttactattccaaatttcacacactac |
1541228 |
T |
|
| Q |
172 |
tcacgtttgtatat |
185 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1541229 |
tcacgtttgtatat |
1541242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 218 - 281
Target Start/End: Original strand, 1541240 - 1541303
Alignment:
| Q |
218 |
tatcaatgtgaacatggttagtttcatgttgctttccaacacaagttttcattctttatggagt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1541240 |
tatcaatgtgaacatggttagtttcatgttgctttccaacacaagttttcattctttatggagt |
1541303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 18 - 49
Target Start/End: Original strand, 1541079 - 1541110
Alignment:
| Q |
18 |
atacattggtatgccgtgtggtttcgagcatc |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1541079 |
atacattggtatgccgtgtggtttcgagcatc |
1541110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 436 - 464
Target Start/End: Original strand, 1541498 - 1541526
Alignment:
| Q |
436 |
tagctcccctcttttgttttatgaatttt |
464 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1541498 |
tagctcccctcttttgttttatgaatttt |
1541526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University