View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17241_low_22 (Length: 382)
Name: NF17241_low_22
Description: NF17241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17241_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 270; Significance: 1e-151; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 18 - 291
Target Start/End: Complemental strand, 27513303 - 27513030
Alignment:
| Q |
18 |
tgtgttatggccggaaatcacggagtaatgggtgtattgaagtcaaactttcaattcagtagcacttatgtacacttgggaatattgtcgtgattttgga |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27513303 |
tgtgttatggctggaaatcacggagtaatgggtgtattgaagtcaaactttcaattcagtagcacttatgtacacttgggaatattgtcgtgattttgga |
27513204 |
T |
 |
| Q |
118 |
tttcactatactaagcattaccgaattgtaaatctctaattgaacaagaaagaagaactgggaatagtcgttatgaatctttctccaaattcagaccaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27513203 |
tttcactatactaagcattaccgaattgtaaatctctaattgaacaagaaagaagaactgggaatagtcgttatgaatctttctccaaattcagaccaat |
27513104 |
T |
 |
| Q |
218 |
gacgttatttctagtaaaatgaatcttcaatccagaaaccaacttatccagagtagtaagcaactatccctcct |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27513103 |
gacgttatttctagtaaaatgaatcttcaatccagaaaccaacttatccagagtagtaagcaactatccctcct |
27513030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 16 - 140
Target Start/End: Complemental strand, 36303693 - 36303569
Alignment:
| Q |
16 |
attgtgttatggccggaaatcacggagtaatgggtgtattgaagtcaaactttcaattcagtagcacttatgtacacttgggaatattgtcgtgattttg |
115 |
Q |
| |
|
||||| || |||||||||||||| || | |||||||| |||||||||||||||||||||| |||||||||||||||||| ||| ||||||| ||||| |
|
|
| T |
36303693 |
attgtattttggccggaaatcacagaatcatgggtgttttgaagtcaaactttcaattcaatagcacttatgtacactttcatatagtgtcgtggttttg |
36303594 |
T |
 |
| Q |
116 |
gatttcactatactaagcattaccg |
140 |
Q |
| |
|
||| || || ||||||||||||||| |
|
|
| T |
36303593 |
gatatcgctgtactaagcattaccg |
36303569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 329 - 365
Target Start/End: Complemental strand, 27513033 - 27512997
Alignment:
| Q |
329 |
tcctagcacattcattaacctttgggatgtgataact |
365 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27513033 |
tcctagcaaattcattaacctttgggatgtgataact |
27512997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University