View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17241_low_36 (Length: 310)
Name: NF17241_low_36
Description: NF17241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17241_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 128 - 292
Target Start/End: Complemental strand, 42824660 - 42824500
Alignment:
| Q |
128 |
aaatgcatattcattaatagttgcggatactaatattaattagaacaactaataataatgaacctaccgaccaaaaaggttttgtgcttagattcaaaat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42824660 |
aaatgcatattcattaatagttgcggatacta---ttaattagaacaactaataataatgaacctaccgaccaaaa-ggttttgtgcttagattcaaaat |
42824565 |
T |
|
| Q |
228 |
tgtggaattaggtgaactactaaccataaatagattctttatcgtttactttcaccatgcatgtc |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42824564 |
tgtggaattaggtgaactactaaccataaacagattctttatcgtttactttcaccatgcatgtc |
42824500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 13 - 109
Target Start/End: Complemental strand, 42824781 - 42824685
Alignment:
| Q |
13 |
aatatagttaccttttgccaattgaagccatggaagatgatttttcccaactataggagtagaccactagagtttgaatgctttttatagtagcaga |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42824781 |
aatatatttaccttttgccaattgaagccatggaagatgatttttcccaactataggagtagaccactagagtttgaatgctttttatagtagcaga |
42824685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University