View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17241_low_40 (Length: 290)
Name: NF17241_low_40
Description: NF17241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17241_low_40 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 18 - 280
Target Start/End: Original strand, 14645186 - 14645448
Alignment:
| Q |
18 |
gtaacacccgatcaactgccagagaaatggttgtgtagcatgctttattggctgtaagttgcttctttatgttggttgaaattatgcagatcatattatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14645186 |
gtaacacccgatcaactgccagagaaatggttatgtagcatgctttattggctgtaagttgcttctttatgttggttgaaattatgcagatcatattatt |
14645285 |
T |
|
| Q |
118 |
ttagatgtctatattgcaccaacacttcacattgaagccgtgttcggtgtctgacatgtaacactgacacggcattgtcacacatggttacattcaaata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14645286 |
ttagatgtctatattgcaccaacacttcacattgaagccgtgttcggtgtctgacatgtaacactgacacggcattgtcacacatggttacattcaaata |
14645385 |
T |
|
| Q |
218 |
atttcttgcctgaaaatatgactgttgtcggcgtcagtttcgtgtccgatgttcttgtctgtg |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
14645386 |
atttcttgcctgaaaatatgactgttgtcggcgtcagtgtcgtgtccgatgttcttgtttgtg |
14645448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 18 - 182
Target Start/End: Original strand, 14661023 - 14661187
Alignment:
| Q |
18 |
gtaacacccgatcaactgccagagaaatggttgtgtagcatgctttattggctgtaagttgcttctttatgttggttgaaattatgcagatcatattatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14661023 |
gtaacacccgatcaactgccagagaaatggttatgtagcatgctttattggctgtaagttgcttctttatgttggttgaaattatgcagatcatattatt |
14661122 |
T |
|
| Q |
118 |
ttagatgtctatattgcaccaacacttcacattgaagccgtgttcggtgtctgacatgtaacact |
182 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14661123 |
ttagatgtttatattgcaccaacacttcacattgaagccgtgttcggtgtctgacatgtaacact |
14661187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 190 - 280
Target Start/End: Original strand, 14661583 - 14661673
Alignment:
| Q |
190 |
cattgtcacacatggttacattcaaataatttcttgcctgaaaatatgactgttgtcggcgtcagtttcgtgtccgatgttcttgtctgtg |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
14661583 |
cattgtcacacatggttacattcaaataatttcttgcctgaaaatatgactgttgtcggcgtcagtgtcgtgtccgatgttcttgtttgtg |
14661673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University