View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17241_low_56 (Length: 231)
Name: NF17241_low_56
Description: NF17241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17241_low_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 26 - 200
Target Start/End: Original strand, 546101 - 546273
Alignment:
| Q |
26 |
gctgaagacgagaacgacaggagggtttctagtcgaaatagttgcttgcagggaagaagccttctgttggtaactcagattgtttttgacggatactcaa |
125 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
546101 |
gctgaagacgagaacgaccggagggtttctagtagaaatagttgcttgcagggaagaaaccttctgttggtaactcagattgtttttgacggatactcaa |
546200 |
T |
 |
| Q |
126 |
caggctgtttcctttggcttttggcatatactcctttcttttaccgtgattggtgctcagttatgttataactta |
200 |
Q |
| |
|
||||||| |||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
546201 |
caggctgcttcctttggc--ttggcataaactcctttcttttaccgtgattggtgctcagttatgttataactta |
546273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University