View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17241_low_57 (Length: 205)
Name: NF17241_low_57
Description: NF17241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17241_low_57 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 20 - 123
Target Start/End: Original strand, 48139767 - 48139870
Alignment:
| Q |
20 |
caattgatgatcgaccctgttattttgtccaccggacaggtacttctttttcttattggttatggttattgctctgtattttattatcttctccacaagt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48139767 |
caattgatgatcgaccctgttattttgtccaccggacaggtacttctttttcttattggttatggttattgctctgtattttattatcttctccacaagt |
48139866 |
T |
 |
| Q |
120 |
tgtc |
123 |
Q |
| |
|
|||| |
|
|
| T |
48139867 |
tgtc |
48139870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 160 - 192
Target Start/End: Original strand, 48139911 - 48139943
Alignment:
| Q |
160 |
ataactcaaacataggtttttctaatccctttg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
48139911 |
ataactcaaacataggtttttctaatccttttg |
48139943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University