View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17242_high_2 (Length: 335)
Name: NF17242_high_2
Description: NF17242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17242_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 2490787 - 2490502
Alignment:
| Q |
1 |
gattatagtaaatctttagagaaattgccaagttaccgaatccttttgtatctcttgctgaattagctctctaacaggtctataagcagcggttgtgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2490787 |
gattatagtaaatctttagagaaattgccaagttaccgaatccttttgtatctcttgctgaattagctctctaacaggtctataagcagcggttgtgcat |
2490688 |
T |
 |
| Q |
101 |
aagttctgcatttaacaattaatgaaaatggaaaatgcattaagacatcagaaactaaacataagaaaagcatttgtagattgtaacacgatagttaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2490687 |
aagttctgcatttaacaattaatgaaaatggaaaatgcattaagacatcagaaactaaacataagaaaagcatttgtagattgtaacacgatagttaagt |
2490588 |
T |
 |
| Q |
201 |
tacggccataggaaaacaataatagagaaaaaccttcagatcacttccactatatccttcagtcatagttgcgagttccttaaaat |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2490587 |
tacggccataggaaaacaataatagagaaaaaccttcagatcacttccactatatccttcagtcatagttgcgagttccttaaaat |
2490502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 51 - 112
Target Start/End: Original strand, 41589433 - 41589494
Alignment:
| Q |
51 |
tctcttgctgaattagctctctaacaggtctataagcagcggttgtgcataagttctgcatt |
112 |
Q |
| |
|
||||||||||||| | ||||||||| || | ||||||||| |||||||| |||||||||||| |
|
|
| T |
41589433 |
tctcttgctgaatcaactctctaactggccgataagcagcagttgtgcacaagttctgcatt |
41589494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 231 - 271
Target Start/End: Complemental strand, 45989493 - 45989453
Alignment:
| Q |
231 |
aaccttcagatcacttccactatatccttcagtcatagttg |
271 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
45989493 |
aaccttaagatcacttccactatatccttctgtcatagttg |
45989453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 231 - 271
Target Start/End: Complemental strand, 44936113 - 44936073
Alignment:
| Q |
231 |
aaccttcagatcacttccactatatccttcagtcatagttg |
271 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| |||||||||| |
|
|
| T |
44936113 |
aaccttaagatcacttccgctatatccttctgtcatagttg |
44936073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University