View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17242_low_5 (Length: 261)
Name: NF17242_low_5
Description: NF17242
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17242_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 30273739 - 30273507
Alignment:
| Q |
18 |
ttaacatgattgatcttgcgtcatgtcatatatgattttagtgaaaacattagtatatggtttatgtcagttgattttgtcgtcaaacctcgtttgacca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30273739 |
ttaacatgattgatcttgcgtcatgtcatatatgattttagtgaaaacattagtatatggtttatgtcagttgattttgtcgtcaaacctcgtttgacta |
30273640 |
T |
|
| Q |
118 |
gaaaagataaaatgtattggtcgagagtattcaagttcaatttctgacctaaacaatttttggttagattttacttacctcttg----gttgtgattaca |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30273639 |
gaaaagataaaatgtattggtcgagagtgttcaagttcaatttctgacttaaacaatttttggttagattttacttacctcttggttggttgtgattaca |
30273540 |
T |
|
| Q |
214 |
ggcagtgataaagaggttgatgactgatgtgcc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30273539 |
ggcagtgataaagaggttgatgactgatgtgcc |
30273507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 206 - 246
Target Start/End: Complemental strand, 25966510 - 25966470
Alignment:
| Q |
206 |
tgattacaggcagtgataaagaggttgatgactgatgtgcc |
246 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
25966510 |
tgattacaggctgtgataaaaaggttgatgactgatgtgcc |
25966470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University