View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17243_low_16 (Length: 222)
Name: NF17243_low_16
Description: NF17243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17243_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 61 - 203
Target Start/End: Complemental strand, 41347900 - 41347758
Alignment:
| Q |
61 |
acatccccaattgtttttacaagacataattaacacgtctaaaggaagaaagtacgaatctcgtaattttaataatgttattagattgaccggtttgtcg |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41347900 |
acatccccaattgtttttacaagacataattaacacgtctaaaggaagaaagtacgaatctcgtaattttaataatgttattagattgaccggtttgtcg |
41347801 |
T |
|
| Q |
161 |
tactaggatgtctggtttcctactaggtacaccaccaccaacc |
203 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41347800 |
tactaggatgtcttgtttcctactaggtacaccaccaccaacc |
41347758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 41347964 - 41347923
Alignment:
| Q |
19 |
actagaggtgtatattctgtgcttcacgggaatggtgactgt |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41347964 |
actagaggtgtatattctgtgcttcacgggaatggtgactgt |
41347923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University