View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17243_low_16 (Length: 222)

Name: NF17243_low_16
Description: NF17243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17243_low_16
NF17243_low_16
[»] chr3 (2 HSPs)
chr3 (61-203)||(41347758-41347900)
chr3 (19-60)||(41347923-41347964)


Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 61 - 203
Target Start/End: Complemental strand, 41347900 - 41347758
Alignment:
61 acatccccaattgtttttacaagacataattaacacgtctaaaggaagaaagtacgaatctcgtaattttaataatgttattagattgaccggtttgtcg 160  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41347900 acatccccaattgtttttacaagacataattaacacgtctaaaggaagaaagtacgaatctcgtaattttaataatgttattagattgaccggtttgtcg 41347801  T
161 tactaggatgtctggtttcctactaggtacaccaccaccaacc 203  Q
    ||||||||||||| |||||||||||||||||||||||||||||    
41347800 tactaggatgtcttgtttcctactaggtacaccaccaccaacc 41347758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 41347964 - 41347923
Alignment:
19 actagaggtgtatattctgtgcttcacgggaatggtgactgt 60  Q
    ||||||||||||||||||||||||||||||||||||||||||    
41347964 actagaggtgtatattctgtgcttcacgggaatggtgactgt 41347923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University