View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17244_high_5 (Length: 331)
Name: NF17244_high_5
Description: NF17244
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17244_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 7 - 323
Target Start/End: Original strand, 38375159 - 38375474
Alignment:
| Q |
7 |
accagaatatgctgagttacaagtttgtaaaatttgacattcattcccaacgccacatctctcattgttgcaatccatactgcaaaaatagtcaaacaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38375159 |
accagaatatgctgagttacaagtttgtaaaatttgacattcattcccaacgccacatctctcattgttgcaatccatactgcaaaaatagtcaaacaaa |
38375258 |
T |
 |
| Q |
107 |
catataaatacacaaaacatgccacattcaaaactcattagcgcatatagcattacacacaaagacaatgctgagtattaattttactcgctaacaccga |
206 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38375259 |
catataaatactcaaaacatgccacattcaaaactcattagcgcatatagcattacacacaaagacaatgctgagtattaattttactcgctgacaccga |
38375358 |
T |
 |
| Q |
207 |
gatagcagaccattgaagtaaacaattgtgtgcannnnnnnnnnaaacaataaaaatgacggaagaattattttcagtgtctcaaaaaatgcatcagccc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38375359 |
gatagcagaccattgaagtaaacaattgtgtgca-tttttttttaaacaataaaaatgacggaagaattattttcagtgtttcaaaaaatgcatcagccc |
38375457 |
T |
 |
| Q |
307 |
tagctatcatttcatct |
323 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38375458 |
tagctatcatttcatct |
38375474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University