View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17245_low_14 (Length: 250)
Name: NF17245_low_14
Description: NF17245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17245_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 235
Target Start/End: Original strand, 1286030 - 1286257
Alignment:
| Q |
8 |
cgaagaatatgtaatatattttggtactgaaaacaagttagtgtacaaataatttaatgtcccaaaaataatctattaaaaaagctatggctctgaaaga |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1286030 |
cgaataatatgtaatatattttggtactgaaaacaagttagtgtacaaataatttaatgtcccaaaaataatctattaaaaaagctatggctctgaaaga |
1286129 |
T |
|
| Q |
108 |
tgattttgaaaggaagaaaatatcaaaactactttgctgacacatatagctacatatatatgaaggaccagcttcaaaagtttgtatgacnnnnnnnnat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1286130 |
tgattttgaaaggaagaaaatatcaaaactactttgctgacacatatagctacatatatatgaaggaccagcttcaaaagtttgtatgacttttttttat |
1286229 |
T |
|
| Q |
208 |
gacactgaaacttacttctcaaaaccct |
235 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
1286230 |
gacactgaaacttacttctcaaaaccct |
1286257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University