View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17245_low_19 (Length: 214)
Name: NF17245_low_19
Description: NF17245
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17245_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 10 - 200
Target Start/End: Complemental strand, 36630924 - 36630734
Alignment:
| Q |
10 |
attatactgcaaatagctgctcattgaactcgaatttgacatcacattagaagtaaatccaggtacctgtttctcctagtagatttgtaatctcttgtgc |
109 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36630924 |
attatattgcaaatagctgctcattgaactcgaatttgacatcacattagaagtaaatccaggtacctgtttctcctagtagatttgtaatctcttgtgc |
36630825 |
T |
 |
| Q |
110 |
caaaagttaactttacgacagattctcttgagagggataatagtaaagatgaattaggcgtaattcctcacttgcaccttcgatgtacaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36630824 |
caaaagttaactttacgacagattctcttgagagggataatagtaaagatgaattaggcgtaattcctcacttccaccttcgatgtacaaa |
36630734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University