View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17246_high_12 (Length: 249)
Name: NF17246_high_12
Description: NF17246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17246_high_12 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 140 - 249
Target Start/End: Complemental strand, 41528059 - 41527950
Alignment:
| Q |
140 |
ttattgatttacaatttcatgatagaatcaaacaaacaaatgacagcttgtcattagacaatcttcaacatataaacaaaatgaagtgaaaacatatagt |
239 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41528059 |
ttattgatttacaatttcatgataaaatcaaacaaacaagtaacagcttgtcattagacaatcttcaacatataaacaaaatgaagtgaaaacatatagt |
41527960 |
T |
 |
| Q |
240 |
accctcttct |
249 |
Q |
| |
|
|||||||||| |
|
|
| T |
41527959 |
accctcttct |
41527950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 177 - 249
Target Start/End: Complemental strand, 41512065 - 41511993
Alignment:
| Q |
177 |
aaatgacagcttgtcattagacaatcttcaacatataaacaaaatgaagtgaaaacatatagtaccctcttct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41512065 |
aaatgacagcttgtcattagacaatcttcaacatataaacaaaatgaagtgagaacatatagtaccctcttct |
41511993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University