View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17246_high_7 (Length: 280)
Name: NF17246_high_7
Description: NF17246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17246_high_7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 20 - 280
Target Start/End: Complemental strand, 39299905 - 39299660
Alignment:
| Q |
20 |
ccatgaacttggttcaaactttcagtctcttcctgatcgtaacgagaatcaaagttaccttgatcgtgcacatgttcgtgatagtgcaaatgtagcagga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299905 |
ccatgaacttggttcaaactttcagtctcttcctgatcgtaacgagaatcaaagttaccttgatcgtgcacatgttcgtgatagtgcaaatgtagcagga |
39299806 |
T |
|
| Q |
120 |
aacagagtaggtggaaaagaagattttggtggttttcgtgatgtgggaaagtttcaaatggaatcaaaaggtttaacagatgatagagaaaaacttgata |
219 |
Q |
| |
|
|| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39299805 |
aa---------------agaagattttggtggtgttcgtgatgtgggaaagtttcaaatggaatcaaaaggtttaaccgatgatagagaaaaacttgata |
39299721 |
T |
|
| Q |
220 |
gccgaaccaaagtggtttctggaacaccacatgtgaaagaaatgaacagaggaatgggaac |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299720 |
gccgaaccaaagtggtttctggaacaccacatgtgaaagaaatgaacagaggaatgggaac |
39299660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University