View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17246_low_14 (Length: 248)

Name: NF17246_low_14
Description: NF17246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17246_low_14
NF17246_low_14
[»] chr7 (2 HSPs)
chr7 (116-234)||(1428205-1428323)
chr7 (29-67)||(1428119-1428157)


Alignment Details
Target: chr7 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 116 - 234
Target Start/End: Original strand, 1428205 - 1428323
Alignment:
116 aaggcaccaagcctgtacttttcttttaatatttcagatatcaagaactaatgaaagaaagttcacggatgccattgtttgatttaagaaagttgaatgc 215  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1428205 aaggcaccgagcctgtacttttcttttaatatttcagatatcaagaactaatgaaagaaagttcacggatgccattgtttgatttaagaaagttgaatgc 1428304  T
216 ttcacttccagttcctttg 234  Q
    ||| || ||||||||||||    
1428305 ttccctaccagttcctttg 1428323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 29 - 67
Target Start/End: Original strand, 1428119 - 1428157
Alignment:
29 tcatggattggtggttgacaataatatgaccatgatatg 67  Q
    |||||||||||||||||||||||||||||||||||||||    
1428119 tcatggattggtggttgacaataatatgaccatgatatg 1428157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University