View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17246_low_7 (Length: 280)

Name: NF17246_low_7
Description: NF17246
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17246_low_7
NF17246_low_7
[»] chr2 (1 HSPs)
chr2 (20-280)||(39299660-39299905)


Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 20 - 280
Target Start/End: Complemental strand, 39299905 - 39299660
Alignment:
20 ccatgaacttggttcaaactttcagtctcttcctgatcgtaacgagaatcaaagttaccttgatcgtgcacatgttcgtgatagtgcaaatgtagcagga 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39299905 ccatgaacttggttcaaactttcagtctcttcctgatcgtaacgagaatcaaagttaccttgatcgtgcacatgttcgtgatagtgcaaatgtagcagga 39299806  T
120 aacagagtaggtggaaaagaagattttggtggttttcgtgatgtgggaaagtttcaaatggaatcaaaaggtttaacagatgatagagaaaaacttgata 219  Q
    ||               |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
39299805 aa---------------agaagattttggtggtgttcgtgatgtgggaaagtttcaaatggaatcaaaaggtttaaccgatgatagagaaaaacttgata 39299721  T
220 gccgaaccaaagtggtttctggaacaccacatgtgaaagaaatgaacagaggaatgggaac 280  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39299720 gccgaaccaaagtggtttctggaacaccacatgtgaaagaaatgaacagaggaatgggaac 39299660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University