View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17247_high_2 (Length: 523)
Name: NF17247_high_2
Description: NF17247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17247_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 4e-70; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 4e-70
Query Start/End: Original strand, 6 - 153
Target Start/End: Original strand, 32575353 - 32575502
Alignment:
| Q |
6 |
cacagaaatggtgggcctagaactagaaatggtgactgtggtggttgggatgagggatgtccacttacagtattttacag--tatattttagaaaaatat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
32575353 |
cacagaaatggtgggcctagaactagaaatggtgactgtggtggttgggatgagggatgtccacttacagtattttaccgtctatattttagaaaaatat |
32575452 |
T |
|
| Q |
104 |
aaacaagccatacaaaaggctgagtgcttgtcagtttatttagttactca |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32575453 |
aaacaagccatacaaaaggctgagtgcttgtcagtttatttagttactca |
32575502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 436 - 510
Target Start/End: Original strand, 32570914 - 32570988
Alignment:
| Q |
436 |
tatattcatttccaccaacctgtttttgcactacggtttttctccgttgttgtggcaataactcatatgcaaagt |
510 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||| || ||||||| | | |||||| |||| ||||||||||||| |
|
|
| T |
32570914 |
tatattcatttcaaccaacctctttctgcactacagtctttctccatagctgtggctataattcatatgcaaagt |
32570988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 113 - 174
Target Start/End: Original strand, 32570356 - 32570416
Alignment:
| Q |
113 |
atacaaaaggctgagtgcttgtcagtttatttagttactcatgtttgtttatatctcatatt |
174 |
Q |
| |
|
||||||||||| |||||| |||||||| || |||||||||| |||||||| ||||||||||| |
|
|
| T |
32570356 |
atacaaaaggc-gagtgcatgtcagttgatctagttactcaggtttgtttgtatctcatatt |
32570416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University