View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17247_high_8 (Length: 218)
Name: NF17247_high_8
Description: NF17247
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17247_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 32804987 - 32805195
Alignment:
| Q |
1 |
aagctagatacttccctcgtaccactttcttggaatcaaagattggatttcaacccagctatgcttggagaagtctgttgtctgcaaaaggggttattga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32804987 |
aagctagatacttccctcgtaccactttcttggaagcaaagattggatttcaacccagctatgcttggagaagtctgttgtctgcaaaagaggttattga |
32805086 |
T |
 |
| Q |
101 |
aactggtgcaagatgggaaataggggatgggagtcttgtctgcatcttcaaagataggtggatcccttgttccaatggttttcttctcaacattccggga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32805087 |
aactggtgcaagatgggaaataggggatgggagtcttgtccgcatcttcaaagataggtggatcccttgttccaatggttttcttctcaacaatccggga |
32805186 |
T |
 |
| Q |
201 |
ggaggtctc |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
32805187 |
ggaggtctc |
32805195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 6095930 - 6095723
Alignment:
| Q |
1 |
aagctagatacttccctcgtaccactttcttggaatcaaagattggatttcaacccagctatgcttggagaagtctgttgtctgcaaaaggggttattga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6095930 |
aagctagatacttccctcgtaccactttcttggaagcaaagattggatttcaacccagctatgcttggagaagtctgttgtctgcaaaaggggttattga |
6095831 |
T |
 |
| Q |
101 |
aactggtgcaagatgggaaataggggatgggagtcttgtctgcatcttcaaagataggtggatcccttgttccaatggttttcttctcaacattccggga |
200 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6095830 |
aactagtgcaagatgggaaataggggatgggagtcttgtccgcatcttcaaagataggtggatcccttgttccaatggttttcttctcaacaatccggga |
6095731 |
T |
 |
| Q |
201 |
ggaggtct |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
6095730 |
ggaggtct |
6095723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University