View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17248_high_11 (Length: 402)
Name: NF17248_high_11
Description: NF17248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17248_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 18 - 369
Target Start/End: Original strand, 32098598 - 32098949
Alignment:
| Q |
18 |
aatgcagtgtcatgtgtgtttgttctaacaattacttataactattaatttacctgaggatggtagttgaacttgtagcaaattacccaccggttcttca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32098598 |
aatgcagtgtcatgtgtgtttgttctaacaattactaatgactattaatttacctgaggatggtagttgaacttgtagcaaattacccaccggttcttca |
32098697 |
T |
 |
| Q |
118 |
atcgggccccacctttgtgttgaatcggttttgtacgagtccacgtgttctaacgggtttccttgattactcacaactaataaatgaaaatctgaatcta |
217 |
Q |
| |
|
|| |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32098698 |
attgggccccacctttgtgttaaatcggttttgtacgagtccacgtgtcctaacgggtttccttgattactcacaactaataaatgaaaatctgaatcta |
32098797 |
T |
 |
| Q |
218 |
aattatttgacccgtcgtttggcgacccgatccgaatatcatcggacatttcaatttgcatcaactcacttggctctacaatagccgtcatcgaggttgc |
317 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32098798 |
aatgatttgacccgtcgtttggcgacccgatccgaatatcatcgggcatttcaatttgcatcaactcacttggctctacaatagccgtcattgaggttgc |
32098897 |
T |
 |
| Q |
318 |
acgtcggatacgacctcctgtttcgtcttcagactcggattcaacttcgtcg |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32098898 |
acgtcggatacgacctcctgtttcgtcttcagactcggattcaacttcgtcg |
32098949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University