View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17248_high_23 (Length: 318)
Name: NF17248_high_23
Description: NF17248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17248_high_23 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 15 - 318
Target Start/End: Complemental strand, 32379026 - 32378705
Alignment:
| Q |
15 |
ttattcttgtttcggagaaagctgaactattgtaaattatgcgattgaaggagttgaagaatgcattgtggttatatactgcaataggagcatgcatgct |
114 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32379026 |
ttattcttgttttggagaaagctgaactattgtaaattatgcgattgaaggagttgaagaatgcattgtggttatatactgcaataggagcatgcatgct |
32378927 |
T |
|
| Q |
115 |
caagatattatttataaacttaactaattcaagcattgctaggcagagattttcgatgggacagaagtaattacaacttataacaactaggatggaatta |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32378926 |
caagatattatttataaacttaactaattcaagcattgctaggcagagattttcgatgggacagaagtaattacaacttataacagctaggatggaatta |
32378827 |
T |
|
| Q |
215 |
gaatttatttataaacacaattatcctataatacaaccact------------------tacacacacattatgcattcatggaattggaagtgaagttg |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32378826 |
gaatttatttataaacacaattatcctataatacaaccactcacacacacacacacacacacacacacattatgcattcatggaattggaagtgaagttg |
32378727 |
T |
|
| Q |
297 |
aagtttgctagccagttggcac |
318 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
32378726 |
aagtttgctagccagttagcac |
32378705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University