View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17248_high_24 (Length: 296)
Name: NF17248_high_24
Description: NF17248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17248_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 19 - 288
Target Start/End: Complemental strand, 5112223 - 5111954
Alignment:
| Q |
19 |
gcaagaggattagtggtgaggtaacattgcaactttctgattcttcaaatataccaatttcttcaaatggattttcttgttgggtgaggattgaatggga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
5112223 |
gcaagaggattagtggtgaggtaacattgcaactttctgattcttcaaatataccaatttcttcaaatggtttctcttgttgggtgaggattgaatggga |
5112124 |
T |
|
| Q |
119 |
aaataatggacagaagaaaaattgtgtgaatgctttttgtgatgttatcaagttgtgttgtgatcaatcaagggactatgttttcacttggaggtttcat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5112123 |
aaataatggacagaagaaaaattgtgtgaatgctttttgtgatgttgtcaagttgtgttgtgatcaatcaagggactatgttttcacttggaggtttcat |
5112024 |
T |
|
| Q |
219 |
actcgttctagggaagcttctcaatccagttgcaatgcttgaaaattgaaacttgcacatagttcttctc |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5112023 |
actcgttctagggaagcttctcaatccagttgcaatgcttgaaaattgaaacttgcacatagttcttctc |
5111954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University