View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17248_high_26 (Length: 267)
Name: NF17248_high_26
Description: NF17248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17248_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 29503117 - 29502863
Alignment:
| Q |
1 |
tatgagtgaatatgatgaaatttgattaacttgcaatggcgatggtattggnnnnnnnacagagaaaaatttgtttggctgaattttggggtgagaaaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29503117 |
tatgagtgaatatgatgaaatttgattaacttgcaatggcgatggtattggtttttttacagagaaaaatttgtttggctgaattttggggtgagaaaga |
29503018 |
T |
 |
| Q |
101 |
gaaagtttgttgttttggtttctttgtttggagaaaaagtctccatctagaggctagaaacagtattttacccgaaagataagggagcataaggaatgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29503017 |
gaaagtttgttgttttggtttctttgtttggagaaaaagtctccatctagaggctagaaacagtattttacccgaaagataagggagcataaggaatgtc |
29502918 |
T |
 |
| Q |
201 |
cttttagttctcaactctcaagctatctttttactaactttcttctaatcatatt |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29502917 |
cttttagttctcaactctcaagctatctttttactaactttcttctaatcttatt |
29502863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 2 - 51
Target Start/End: Complemental strand, 29492725 - 29492676
Alignment:
| Q |
2 |
atgagtgaatatgatgaaatttgattaacttgcaatggcgatggtattgg |
51 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||| |||||| |||| |
|
|
| T |
29492725 |
atgagtgaatataatgaaatttgattaatctgcaatggtgatggtgttgg |
29492676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University