View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17248_high_36 (Length: 245)
Name: NF17248_high_36
Description: NF17248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17248_high_36 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 245
Target Start/End: Original strand, 8757679 - 8757906
Alignment:
| Q |
18 |
gagacaaggatgatcggtccattggtaaaacttcttgatgaaagagaggcagaggtttcaagggaggcgtcaatcgcgcttaggaaattcgctggtagtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
8757679 |
gagacaaggatgatcggtccattggtaaaacttcttgatgaaagagaggcagaggtttcaagggaggcgtcaatcgcgcttaggaaattcgccggcagtg |
8757778 |
T |
 |
| Q |
118 |
aaaactaccttcatgttgatcactccaaggcaattatcagtgcaggtggggcaaaacacttgattcagcttgtatattttggagaacaaatggttcagat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8757779 |
aaaactaccttcatgttgatcactccaacgcaattatcagtgcaggtggggcaaaacacttgattcagcttgtatattttggagaacaaatggttcagat |
8757878 |
T |
 |
| Q |
218 |
tccagcattggttctgctctcttacatt |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
8757879 |
tccagcattggttctgctctcttacatt |
8757906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University