View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17248_high_44 (Length: 232)
Name: NF17248_high_44
Description: NF17248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17248_high_44 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 72 - 203
Target Start/End: Complemental strand, 21906973 - 21906832
Alignment:
| Q |
72 |
ttctagcatatgttgcatatatcttcttccatttgaaaactcatcgaaaaatatttgatgcacaagaggttattactaattatgtaattt---------- |
161 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21906973 |
ttctagcatacgttgcatatatcttcttccatttgaaaactcatcgaaaaatatttgatgcacaagaggttattactaattatgtaatttcacatttgag |
21906874 |
T |
|
| Q |
162 |
cacaattgtatattgatgtataccaaaggatttaattagtat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21906873 |
cacaattgtatattgatgtataccaaaggatttaattagtat |
21906832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 45
Target Start/End: Complemental strand, 21907005 - 21906975
Alignment:
| Q |
15 |
attattctatggccaattttactcttcaatt |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21907005 |
attattctatggccaattttactcttcaatt |
21906975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 18 - 143
Target Start/End: Complemental strand, 29785068 - 29784943
Alignment:
| Q |
18 |
attctatggccaattttactcttcaattgtcaagagcaagcagtgttgtcatgcttctagcatatgttgcatatatcttcttccatttgaaaactcatcg |
117 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
29785068 |
attctattgccaattctactcttcaattgtcaagagctagcagtgttgttatgcttctagcatatgtttcatatatcttcttccaattgaaaactcatcg |
29784969 |
T |
|
| Q |
118 |
aaaaatatttgatgcacaagaggtta |
143 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
29784968 |
aaaaatatttgatgcacaagaggtta |
29784943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University