View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17248_high_7 (Length: 455)
Name: NF17248_high_7
Description: NF17248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17248_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 51; Significance: 5e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 31 - 89
Target Start/End: Original strand, 1459216 - 1459274
Alignment:
| Q |
31 |
acagcaacgcaatatattgcaagaaaaaacatcccgaattgatcccgatgctgctttag |
89 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1459216 |
acagcaatgcaatatattgcgagaaaaaacatcccgaattgatcccgatgctgctttag |
1459274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 128 - 161
Target Start/End: Complemental strand, 13713665 - 13713632
Alignment:
| Q |
128 |
gtggaaaacatgatggtcaatgtgttgaccagcc |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
13713665 |
gtggaaaacatgatggtcaatgtgttgaccagcc |
13713632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 1052547 - 1052575
Alignment:
| Q |
1 |
gttgtacaaatatcatttctcttaataaa |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1052547 |
gttgtacaaatatcatttctcttaataaa |
1052575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University