View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17248_low_18 (Length: 378)
Name: NF17248_low_18
Description: NF17248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17248_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 95 - 370
Target Start/End: Complemental strand, 36272157 - 36271882
Alignment:
| Q |
95 |
aaaatgaagtagctatgggaagaggagaatatagtggttatggaggaggatgtggcggaggagaatatcaaatgcctcatatgagaggaggagaacaaga |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36272157 |
aaaatgaagtagctatgggaagaggagaatatagtggttatggaggaggatgtggcggaggagaatatcaaatgcctcatatgagaggaggagaacaaga |
36272058 |
T |
|
| Q |
195 |
aggctttgaaaatcaagggccctgggaatgtccataacaattagagatatgaatgcaagtgttgcgtcccataaagtatgtataagaaaaatatgcaatt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36272057 |
aggctttgaaaatcaagggccctgggaatgtccataacaaatagagatatgaatgcaagtgttgcgtcccataaagtatgtataagaaaaatatgcaatt |
36271958 |
T |
|
| Q |
295 |
tatcttactccatgtctagtctttattaggatgaacttttttcacttaaattaaaatatattttattgatattctt |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36271957 |
tatcttactccatgtctagtctttattaggatgaacttttttcacttaaattaaaatatattttattgatattctt |
36271882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University