View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17248_low_36 (Length: 249)
Name: NF17248_low_36
Description: NF17248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17248_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 29503169 - 29503399
Alignment:
| Q |
1 |
ttcttattttgatgatttgatcttgttagagagaatattttaatggcttttcgtgcctttagatcacaatcagtatcaacacaaggagcgtataacttag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29503169 |
ttcttattttgatgatttgatcttgttagagagaatattttaatggcttttcgtgcctttagatcacaatcagtatcaacacaaggagcgtataacttag |
29503268 |
T |
 |
| Q |
101 |
cacagaaaacaatagaggagcctgttccaagcaaagttgcacaaagcacggtcacatgtttataccaagcaaatgtagctggattttggagaaatgtctc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29503269 |
cacagaaaacaatagaggagcctgttccaagcaaagttgcacaaagcacggtcacatgtttataccaagcaaatgtagctggattttggagaaatgtctc |
29503368 |
T |
 |
| Q |
201 |
agttttatggtgcaaaaatcttatgaaccat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29503369 |
agttttatggtgcaaaaatcttatgaaccat |
29503399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 29492778 - 29493008
Alignment:
| Q |
1 |
ttcttattttgatgatttgatcttgttagagagaatattttaatggcttttcgtgcctttagatcacaatcagtatcaacacaaggagcgtataacttag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
29492778 |
ttcttattttgatgatttgatcttgttagagaaaatattttaatggcttttcgtgcctttagatcacaatcggtatcaacacaaggagcatataacttag |
29492877 |
T |
 |
| Q |
101 |
cacagaaaacaatagaggagcctgttccaagcaaagttgcacaaagcacggtcacatgtttataccaagcaaatgtagctggattttggagaaatgtctc |
200 |
Q |
| |
|
|||| ||||||| |||||||| ||||||||||||||||||||||||||||||| ||||||| ||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
29492878 |
cacacaaaacaacagaggagcatgttccaagcaaagttgcacaaagcacggtcgcatgtttctacaaagcaattgtagctggattttggagaaatgtctc |
29492977 |
T |
 |
| Q |
201 |
agttttatggtgcaaaaatcttatgaaccat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29492978 |
agttttatggtgcaaaaatcttatgaaccat |
29493008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 97 - 231
Target Start/End: Original strand, 29509309 - 29509443
Alignment:
| Q |
97 |
ttagcacagaaaacaatagaggagcctgttccaagcaaagttgcacaaagcacggtcacatgtttataccaagcaaatgtagctggattttggagaaatg |
196 |
Q |
| |
|
|||||||||||||||| ||||| || ||||||| |||||||| ||||||| |||||||||||||| |||||||||| ||||||||||||||| ||||||| |
|
|
| T |
29509309 |
ttagcacagaaaacaacagaggtgcttgttccaggcaaagtttcacaaagaacggtcacatgtttctaccaagcaattgtagctggattttgaagaaatg |
29509408 |
T |
 |
| Q |
197 |
tctcagttttatggtgcaaaaatcttatgaaccat |
231 |
Q |
| |
|
|||| ||||||||||||||||||| ||| |||||| |
|
|
| T |
29509409 |
tctcggttttatggtgcaaaaatcgtatcaaccat |
29509443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 135 - 201
Target Start/End: Original strand, 29489166 - 29489232
Alignment:
| Q |
135 |
agttgcacaaagcacggtcacatgtttataccaagcaaatgtagctggattttggagaaatgtctca |
201 |
Q |
| |
|
||||||||||| || |||||||||||| |||||||||||||||||| |||||| ||||||| ||||| |
|
|
| T |
29489166 |
agttgcacaaaacatggtcacatgtttctaccaagcaaatgtagctagattttagagaaatatctca |
29489232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University