View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17248_low_43 (Length: 239)
Name: NF17248_low_43
Description: NF17248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17248_low_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 15 - 220
Target Start/End: Complemental strand, 40191001 - 40190796
Alignment:
| Q |
15 |
taatactgagcaagacgtgtctgaccttgtttgttcaccattaaaacgaatcggatccccatttttattcctcttcctctttatctttatctttctttct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40191001 |
taatactgagcaagacgtgtctgaccttgtttgttcaccattaaaacgaatcggatccccatttttattcctctttctctttatctttatctttctttct |
40190902 |
T |
|
| Q |
115 |
gctacacacaacggaggaggatgagaagtgaaatcgtgttttcaagtgcagtatcaagatagttgtcttggaagcatttaacctccgcattgacgaaagt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40190901 |
gctacacacaacggaggaggatgagaagtgaaatcgtgttttcaagtgcagtatcaagatagttgtcttggaagcatttaacctccgcattgacgaaagt |
40190802 |
T |
|
| Q |
215 |
cctaat |
220 |
Q |
| |
|
|||||| |
|
|
| T |
40190801 |
cctaat |
40190796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 15 - 79
Target Start/End: Complemental strand, 42974653 - 42974589
Alignment:
| Q |
15 |
taatactgagcaagacgtgtctgaccttgtttgttcaccattaaaacgaatcggatccccatttt |
79 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42974653 |
taatactgagcaagacgggtctgtccttgtttgttcaccattaacacgaatcggatccccatttt |
42974589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University