View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17248_low_46 (Length: 238)
Name: NF17248_low_46
Description: NF17248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17248_low_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 3 - 221
Target Start/End: Complemental strand, 22198631 - 22198412
Alignment:
| Q |
3 |
gtgtactaattcgttgagtcaaataagacaacaatgtacgacaaaactcttcctcaaaagttttaaaaatactgcgttggaacctaaaacttttgattaa |
102 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||| |
|
|
| T |
22198631 |
gtgtactaattcgttgagtcgaataagacaacaatgtacgacaaaactcttcctcaaaagttttaaaaatactgcgttgaaatctaaattttttgattaa |
22198532 |
T |
 |
| Q |
103 |
gttaaaagcgatctgaaccatgtatcttagtgctcttggttcccataccttttagtaacacaattt-nnnnnnntaaaacaatgaagcttgtggtccaca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22198531 |
gttaaaagcgatctgaaccatgtatcttagtgctcttggttcccataccttttagtaacacaatttaaaaaaaataaaacaatgaagcttgtggtccaca |
22198432 |
T |
 |
| Q |
202 |
cacactttgcacattctttc |
221 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
22198431 |
cacactttgcacattctttc |
22198412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University