View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17248_low_52 (Length: 219)
Name: NF17248_low_52
Description: NF17248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17248_low_52 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 219
Target Start/End: Complemental strand, 21907179 - 21906984
Alignment:
| Q |
15 |
gacagattgaacatgttatttgactttcgttgttaatttaattttgtttaaccaatcaatttgttttgttatttgattattaaatgaacagaaacaagca |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21907179 |
gacagattgagcatgttatttgactttcgttgttaatttaattttgtttaaccaatcaatttgttttgttatttgattattaaatgaacagaaacaagca |
21907080 |
T |
|
| Q |
115 |
gatgtaaattcattgcttttgttgctgggattgctatgccatttgctgccattaatgtttaaatacgcttttggctgggggaaattattctatggccaat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21907079 |
gatgtaaattcattgcttttgttgctgggattgctatgccatttgctgccat---------aatacgcttttggctgcgggaaattattctatggccaat |
21906989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 15 - 215
Target Start/End: Complemental strand, 29785253 - 29785054
Alignment:
| Q |
15 |
gacagattgaacatgttatttgactttcgttgttaatttaattttgtttaaccaatcaatttgttttgttatttgattattaaatgaacagaaacaagca |
114 |
Q |
| |
|
|||||||||| |||||||||| | |||| ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29785253 |
gacagattgagcatgttatttaattttcattgttaatttaattttgtttaactgatcaatttgttatgttatttgattattaaatgaacagaaacaagct |
29785154 |
T |
|
| Q |
115 |
gatgtaaattcattgcttttgttgctgggattgctatgccatttgctgccattaatgtttaaatacgcttttggctgggggaaattattctatggccaat |
214 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| || || || ||||||||||||||| ||||||| |||||| |
|
|
| T |
29785153 |
gatgtaaattcattgcttctgttgctgggattgctatgccatttgctgccattgatgttcaagtatgc-attggctgggggaaatcattctattgccaat |
29785055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University