View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17248_low_55 (Length: 218)
Name: NF17248_low_55
Description: NF17248
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17248_low_55 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 202
Target Start/End: Complemental strand, 5994137 - 5993952
Alignment:
| Q |
17 |
aatatgactgattaatcattcttagtctttgctttcaaatgtcattgatcattcaaacaatacctcatacaagcttgataattttatatgttggtgcatg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5994137 |
aatatgactgattaatcattcttagtctttgctttcaaatgtcattgatcattcaaacaatacatcatacaagcttgataattttatatgttggtgcatg |
5994038 |
T |
|
| Q |
117 |
atcatcaaattcagcacctacctatattagcaattgtctaattttattatgatcaaaacatccagatcttaaggatgactggtagc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5994037 |
atcatcaaattcagcacctacctatattagcaattgtctaattttattatgatcaaaacatcaagatcttaaggatgactggtagc |
5993952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University