View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1724_high_7 (Length: 251)
Name: NF1724_high_7
Description: NF1724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1724_high_7 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 251
Target Start/End: Complemental strand, 22050526 - 22050293
Alignment:
| Q |
18 |
cgttgcatcaatgtcgagttcaatcaaaactacaatcatccattaatcacaaaaggatggattgagttgagaacnnnnnnnggtatcaatggcaacgggt |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||| |
|
|
| T |
22050526 |
cgttgcatgaatgtcgagttcaatcaaaactacaatcatccattaatcacaaaaggatggattgagttgagagctttttttggtatcaatggcaacaggt |
22050427 |
T |
 |
| Q |
118 |
ttcttttactcacatatcatggagaaaatctatttggtattgatgtaggacaacgtcaattcaatcctttggaattaccaaattatcatagctatcgata |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22050426 |
ttcttttactcacatatcatggagaaaatctatttggtattgatgtaggacaacgtcaattcaatcctttggaattatgaaattatcatagctatcgata |
22050327 |
T |
 |
| Q |
218 |
cagtgcgcttgagccggcaccatttcaagttacc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
22050326 |
cagtgcgcttgagccggcaccatttcaagttacc |
22050293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University