View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1724_low_12 (Length: 211)
Name: NF1724_low_12
Description: NF1724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1724_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 14 - 193
Target Start/End: Original strand, 34076594 - 34076773
Alignment:
| Q |
14 |
cacagacagaaaattcacgagtgtatcaccgtccttaagctgaggaacacacacatactcttgtcttcaattctcaacaatgcatatccaacccaaacaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34076594 |
cacagacagaaaattcacgagtgtatcaccgtccttaagctgaggaacacacacatactcttgtcttcaattctcaacaatgcatatccaacccaaacaa |
34076693 |
T |
|
| Q |
114 |
ttcatcacatttaggttggtgaagttttcacgagctaaaaccatttgcgtgtctctttattcacccatacccaccaaact |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34076694 |
ttcatcacatttaggttggtgaagttttcacgagctaaaaccatttgcgtgtctctttattcacccatacccaccaaact |
34076773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University